bacterium blast

March 2, 2012 9:26 PM

New to NCIB and BLAST. Looking for help finding homologous regions of a bacterium plasmid across several sequences.

Hello All!
I am relatively new to the NCIB database and BLAST. I have been running standard PCR in the lab, (looking for a novel soil-borne bacterium (Agrobacterium)) for some time now but would like to design a new set of primers (and/or) check for homology amongst know sequenced strains. I have asked around the lab and searched on-line, but can anyone point me in the right direction to understanding how to run a degenerative primers set on several sequences at once.
I have three primer sets I would like to test in silica for the (Ti) plasmid of Agrobacterium but have only be able to figure out (was told) how to do a local search on one sequence at a time for an exact primer sequence.
Thanks everyone!

posted by Benzle to Technology (5 answers total)

You can start by going here and copy/paste-ing sequences you want to find homologies for into the box in FASTA format. FASTA is really simple, its just,

>The_Name_Of_Your_Sequence_with_no_spaces
atcgatcgactgagcatcgtacgatcgtacgatcgatcgatcgatcgatcgatcgatcgatgatcgatcgcatctcgatcgatcgatcgactgacgactgatcgactgacactgactgactgactgctgtacgatcgctgactgactgactgatcgatcgactgactgacgtatcgatcatagatcagtcgtgtgtcatcgactgatcgatcgtacgatacgatcgtagc...

Then punch the BLAST button at the bottom of the page.
posted by Blasdelb at 10:08 PM on March 2, 2012

First off, if you're dealing with Agrobacterium, I would recommend doing your sequence searching via the Virginia Tech Agrobacterium genome sequence database rather than NCBI - it's far less cumbersome. It has full sequences for tumefaciens (C58), vitis (S4), and radiobacter (K84), as well as a comparison of the full genomes across these species (including a list of homologous genes shared by two or all three of them). I can't recall exactly which C58 was used for this sequencing project, but knowing the lineage of your lab line is going to matter (i.e., did it come from Nestor's lab, or Farrand's? there's actually some big deletions in one of them, though they're largely confined to the At plasmid).

Now, between your last question and this one, I'm guessing that you're trying to perform degenerate PCR on Ti plasmid sequences in order to identify these novel strains of Agrobacterium, probably out of soil samples. Are you looking for new species? Or novel strains of A. tumefaciens? Either way, I suspect that using Ti plasmid sequences as your indicator is going to be problematic -- if you're looking for new species, well, only A. tumefaciens even has a proper Ti plasmid. And if you're looking for novel strains of A.t. from soil samples, well, only ~10% of any given soil population will even carry a Ti plasmid at all, and given the frequency of conjugal transfer, plasmid variation may not correlate particularly well to host variation.

If I'm not guessing well about your study, or if you have more specific questions, feel free to MeMail me. I did my PhD on A. tumefaciens genetics, and may be able to help point you in a useful direction.
posted by amelioration at 11:15 PM on March 2, 2012 [1 favorite]

Benzie: Go to the link Blasdelb provided and make sure the 'Align 2 or more' button is unchecked and the Database is set to 'nr', not Human.

Can't you stick 'n' in where you're looking for your degenerate primers? That's certainly how you order degenerate primers... I've never BLASTed for them since BLAST should return non-exact matches.

Also, I don't know too much about it, but Agrobacterium is a plant biology powerhouse (at least, it's used a lot for transformation in corn?). I'd worry you're going to get a ton of clones/vectors... I've avoided really working with Agro at work though, so I can't help too specifically there, sorry.

Also, thanks a lot Blasdelb, now I feel compelled to BLAST that...and I'm finding nothing. Sonofa...no. I refuse to translate that, it's 2AM, I was already at work 12 hours today, I am going to bed.
posted by maryr at 11:18 PM on March 2, 2012

On preview, amelioration has a much better answer.
posted by maryr at 11:19 PM on March 2, 2012

Have you found "primer BLAST" on the NCBI website? On the main BLAST page, it is under "specialized BLAST". You can use your own primers to see if they hybridize to anything other than what you expect.

I'm not sure if you can use the IUPAC degenerate bases in primer BLAST. But, you could try just making the in silico PCR less specific.

Another possibility that will search only completed genomes (and for my organism, not all of the completed genomes) is this in silico PCR server.
posted by SandiBeech at 8:14 AM on March 3, 2012 [1 favorite]